Opcml^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Opcml^em1(IMPC)J
• Name: opioid binding protein/cell adhesion molecule-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6727365
• Gene: Opcml Location: Chr9:27702071-28836706 bp, + strand Genetic Position: Chr9, 13.73 cM
• Alliance: Opcml^em1(IMPC)J page
• IMPC: Opcml gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGTTGGTTGACTAAGGGGA and GAGCTGAGAACTCAACAAAA, which resulted in a 441 bp deletion beginning at Chromosome 9 position 28,813,224 bp and ending after 28,813,664 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000537413 (exon 6) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 213 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Opcml Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)