Pcdhga7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdhga7^em1(IMPC)J
• Name: protocadherin gamma subfamily A, 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6727352
• Gene: Pcdhga7 Location: Chr18:37847887-37974926 bp, + strand Genetic Position: Chr18, 19.58 cM
• Alliance: Pcdhga7^em1(IMPC)J page
• IMPC: Pcdhga7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGCCTGGACAGAG and GGGTGAAGCCCCAAGTTCCC, which resulted in a 2435 bp deletion beginning at Chromosome 18 position 37,847,990 bp and ending after 37,850,424 bp (GRCm39/mm39). This mutation deletes 2435 bp from ENSMUSE00001346069 (exon 1) including the start site but leaves the last 3 nucleotides before the end of the exon, and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pcdhga7 Mutation: 86 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)