Tmem229b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem229b^em1(IMPC)J
• Name: transmembrane protein 229B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6727346
• Gene: Tmem229b Location: Chr12:79008569-79054333 bp, - strand Genetic Position: Chr12, 35.51 cM
• Alliance: Tmem229b^em1(IMPC)J page
• IMPC: Tmem229b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGGTGACTAGAGAGAGCGA and TAGACAATAGGGACGATGGT, which resulted in a 3696 bp deletion beginning at Chromosome 12 position 79,008,403 bp and ending after 79,012,098 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000932830 (exon 3) and 322 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem229b Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)