About   Help   FAQ
Trpm3em1Alsh
Endonuclease-mediated Allele Detail
Summary
Symbol: Trpm3em1Alsh
Name: transient receptor potential cation channel, subfamily M, member 3; endonuclease-mediated mutation 1, Alan Shiels
MGI ID: MGI:6727113
Synonyms: Trpm3M, Trpm3-mutant
Gene: Trpm3  Location: Chr19:22116410-22972774 bp, + strand  Genetic Position: Chr19, 16.05 cM
Alliance: Trpm3em1Alsh page
Mutation
origin
Strain of Origin:  C57BL/6J x CBA
Mutation
description
Allele Type:    Endonuclease-mediated (Dominant negative)
Mutation:    Single point mutation
 
Mutation detailsIsoleucine codon 65 in exon 4 was targeted with sgRNAs (targeting TGTTTCAGGCTCAGAAATCCNGG and ATAAAATGCTCTTTCAATCCNGG ) and an ssODN (ATGGGGGTCTTTGGTGCTCGGTATGATGTGAACACATTCTCTTTTATAAAATGCTCTTTCCATCCAAGACTTCTGAGCCTGAAACAAAACGAGAGAGAGAGAAAAAAAGATGAATATAAATTTTAAATCT ) using CRISPR/Cas9 technology, resulting in a T-to-G mutation (c.195T>G) that changes it to a methionine codon (p.I65M). This mutation mimics a mutation associated with early-onset or pediatric cataract in humans. (J:307352)
Inheritance:    Semidominant
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Trpm3 Mutation:  105 strains or lines available
References
Original:  J:307352 Zhou Y, et al., Mutation of the TRPM3 cation channel underlies progressive cataract development and lens calcification associated with pro-fibrotic and immune cell responses. FASEB J. 2021 Feb;35(2):e21288
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory