Trpm3^em1Alsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trpm3^em1Alsh
• Name: transient receptor potential cation channel, subfamily M, member 3; endonuclease-mediated mutation 1, Alan Shiels
• MGI ID: MGI:6727113
• Synonyms: Trpm3^M, Trpm3-mutant
• Gene: Trpm3 Location: Chr19:22116410-22972774 bp, + strand Genetic Position: Chr19, 16.05 cM
• Alliance: Trpm3^em1Alsh page

Mutation origin

• Strain of Origin: C57BL/6J x CBA

Mutation description

• Allele Type: Endonuclease-mediated (Dominant negative)
• Mutation: Single point mutation
• Mutation details: Isoleucine codon 65 in exon 4 was targeted with sgRNAs (targeting TGTTTCAGGCTCAGAAATCCNGG and ATAAAATGCTCTTTCAATCCNGG ) and an ssODN (ATGGGGGTCTTTGGTGCTCGGTATGATGTGAACACATTCTCTTTTATAAAATGCTCTTTCCATCCAAGACTTCTGAGCCTGAAACAAAACGAGAGAGAGAGAAAAAAAGATGAATATAAATTTTAAATCT ) using CRISPR/Cas9 technology, resulting in a T-to-G mutation (c.195T>G) that changes it to a methionine codon (p.I65M). This mutation mimics a mutation associated with early-onset or pediatric cataract in humans. (J:307352)
• Inheritance: Semidominant

Disease models

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trpm3 Mutation: 105 strains or lines available

References

• Original: J:307352 Zhou Y, et al., Mutation of the TRPM3 cation channel underlies progressive cataract development and lens calcification associated with pro-fibrotic and immune cell responses. FASEB J. 2021 Feb;35(2):e21288
• All: 2 reference(s)