About   Help   FAQ
Klem2Adiuj
Endonuclease-mediated Allele Detail
Summary
Symbol: Klem2Adiuj
Name: klotho; endonuclease-mediated mutation 2, MODEL-AD Center
MGI ID: MGI:6725126
Synonyms: KlF352V, KL-V/S
Gene: Kl  Location: Chr5:150876072-150917282 bp, + strand  Genetic Position: Chr5, 89.77 cM, cytoband G3
Alliance: Klem2Adiuj page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 endonuclease-mediated genome editing is used to create a F352V missense mutation (TTT to GTT). Guide RNAs (TTCTCAGATTCAGTAAAATC and ATTTTACTGAATCTGAGAAG) were selected to target position 352 of exon 2. The mutation corresponds to a human mutation associated with decreased susceptibility to late-onset Alzheimer's disease. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kl Mutation:  51 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory