Kl^em2Adiuj
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kl^em2Adiuj
• Name: klotho; endonuclease-mediated mutation 2, MODEL-AD Center
• MGI ID: MGI:6725126
• Synonyms: Kl^F352V, KL-V/S
• Gene: Kl Location: Chr5:150876072-150917282 bp, + strand Genetic Position: Chr5, 89.77 cM, cytoband G3
• Alliance: Kl^em2Adiuj page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 endonuclease-mediated genome editing is used to create a F352V missense mutation (TTT to GTT). Guide RNAs (TTCTCAGATTCAGTAAAATC and ATTTTACTGAATCTGAGAAG) were selected to target position 352 of exon 2. The mutation corresponds to a human mutation associated with decreased susceptibility to late-onset Alzheimer's disease. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kl Mutation: 51 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)