About   Help   FAQ
Il34em3Adiuj
Endonuclease-mediated Allele Detail
Summary
Symbol: Il34em3Adiuj
Name: interleukin 34; endonuclease-mediated mutation 3, MODEL-AD Center
MGI ID: MGI:6725114
Gene: Il34  Location: Chr8:111468461-111532556 bp, - strand  Genetic Position: Chr8, 57.68 cM
Alliance: Il34em3Adiuj page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 endonuclease-mediated genome editing is used to delete exons 3-7 using single stranded guide RNAs (TCAAGCCTGACAAGTACTGA and ATCAAGCCTGACAAGTACTG upstream of exon 3 and CCGTGATACCACCAGAAGGC and GGCTCCGTGATACCACCAGA downstream of exon 7). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Il34 Mutation:  25 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory