About   Help   FAQ
Ddi1em1Qsh
Endonuclease-mediated Allele Detail
Summary
Symbol: Ddi1em1Qsh
Name: DNA-damage inducible 1; endonuclease-mediated mutation 1, Qinghua Shi
MGI ID: MGI:6724340
Synonyms: Ddi1-
Gene: Ddi1  Location: Chr9:6265028-6266547 bp, - strand  Genetic Position: Chr9, 2.46 cM, cytoband A1
Alliance: Ddi1em1Qsh page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

The single-exon gene was targeted with an sgRNA (targeting GCTGTTCCATGTAAACGATC) using CRISPR/Cas9 technology, resulting in a 26 bp deletion (c.120-145del, p.P41Hfs*8). Western blot and immunohistochemistry experiments confirmed the absence of peptide expression in testes. (J:307592)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ddi1 Mutation:  20 strains or lines available
References
Original:  J:307592 Yousaf A, et al., Normal spermatogenesis and fertility in Ddi1 (DNA damage inducible 1) mutant mice. Reprod Biol. 2020 Dec;20(4):520-524
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory