Trp53bp1^em2Baz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trp53bp1^em2Baz
• Name: transformation related protein 53 binding protein 1; endonuclease-mediated mutation 2, Hisham Bazzi
• MGI ID: MGI:6723824
• Gene: Trp53bp1 Location: Chr2:121023762-121101888 bp, - strand Genetic Position: Chr2, 60.37 cM
• Alliance: Trp53bp1^em2Baz page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 31 bp deletion (GGACCCTACTGGAAGTCAATTGGATTCAGAT) in exon 2 using the gRNA TACTGGAAGTCAATTGGATT. (J:306061)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trp53bp1 Mutation: 100 strains or lines available

References

• Original: J:306061 Damen M, et al., High proliferation and delamination during skin epidermal stratification. Nat Commun. 2021 May 28;12(1):3227
• All: 1 reference(s)