Cfap53^em2Hmd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap53^em2Hmd
• Name: cilia and flagella associated protein 53; endonuclease-mediated mutation 2, Hiroshi Hamada
• MGI ID: MGI:6720858
• Synonyms: Cfap53^-
• Gene: Cfap53 Location: Chr18:74416171-74493055 bp, + strand Genetic Position: Chr18, 50.7 cM, cytoband E2
• Alliance: Cfap53^em2Hmd page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 2-8 were targeted with two sgRNAs (targeting CCTCTTAATTTTTACTTATTGTA and GGTGAGCCAAAATATGGGCC) using CRISPR/Cas9 technology, resulting in the deletion of the exons. (J:301033)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cfap53 Mutation: 55 strains or lines available

References

• Original: J:301033 Ide T, et al., CFAP53 regulates mammalian cilia-type motility patterns through differential localization and recruitment of axonemal dynein components. PLoS Genet. 2020 Dec;16(12):e1009232
• All: 1 reference(s)