About   Help   FAQ
Adslem1Svap
Endonuclease-mediated Allele Detail
Summary
Symbol: Adslem1Svap
Name: adenylosuccinate lyase; endonuclease-mediated mutation 1, Svante Paabo
MGI ID: MGI:6720350
Gene: Adsl  Location: Chr15:80832691-80855147 bp, + strand  Genetic Position: Chr15, 37.95 cM
Alliance: Adslem1Svap page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsCodons Arg428Ala429 (CGGGCA) were changed to GlnVal (CAGGTT) (p.428_429delinsQV) using two sgRNAs (targeting GGCTGAAGTAGGCATCTGCC and CTCACAGCTGGAGCACTTGC) and an ssODN (GTGGTCAAGCAGGAAGGAGGTGACAATGACCTTATAGAGCGCATCCAGGTTGACGCCTACTTCAGCCCCATCCACTCACAGCTGGAGCACTTGCTGGAC) with CRISPR/Cas9 technology. This mutation in the active domain mimics the sequence in the human ortholog, thought to be associated with the lower stability/activity of the enzyme in modern humans compared to other tetrapods, other primates and human ancestors. (J:307180)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Adsl Mutation:  38 strains or lines available
References
Original:  J:307180 Stepanova V, et al., Reduced purine biosynthesis in humans after their divergence from Neandertals. Elife. 2021 May 4;10:e58741
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory