Adslem1Svap
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Adslem1Svap |
| Name: |
adenylosuccinate lyase; endonuclease-mediated mutation 1, Svante Paabo |
| MGI ID: |
MGI:6720350 |
| Gene: |
Adsl Location: Chr15:80832691-80855147 bp, + strand Genetic Position: Chr15, 37.95 cM
|
| Alliance: |
Adslem1Svap page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Codons Arg428Ala429 (CGGGCA) were changed to GlnVal (CAGGTT) (p.428_429delinsQV) using two sgRNAs (targeting GGCTGAAGTAGGCATCTGCC and CTCACAGCTGGAGCACTTGC) and an ssODN (GTGGTCAAGCAGGAAGGAGGTGACAATGACCTTATAGAGCGCATCCAGGTTGACGCCTACTTCAGCCCCATCCACTCACAGCTGGAGCACTTGCTGGAC) with CRISPR/Cas9 technology. This mutation in the active domain mimics the sequence in the human ortholog, thought to be associated with the lower stability/activity of the enzyme in modern humans compared to other tetrapods, other primates and human ancestors.
(J:307180)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Adsl Mutation: |
38 strains or lines available
|
|
| Original: |
J:307180 Stepanova V, et al., Reduced purine biosynthesis in humans after their divergence from Neandertals. Elife. 2021 May 4;10:e58741 |
| All: |
1 reference(s) |
|