About   Help   FAQ
Ip6k1em1Seyk
Endonuclease-mediated Allele Detail
Summary
Symbol: Ip6k1em1Seyk
Name: inositol hexaphosphate kinase 1; endonuclease-mediated mutation 1, Seyun Kim
MGI ID: MGI:6718594
Synonyms: IP6K1-KO
Gene: Ip6k1  Location: Chr9:107879847-107925981 bp, + strand  Genetic Position: Chr9, 59.07 cM, cytoband F2
Alliance: Ip6k1em1Seyk page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2, containing the ATG start codon, was targeted with two sgRNAs (targeting TTTGTCAAACCATGGAAGTGGGG and CCGCCCACCTGATGGATGAAGGG) using CRISPR/Cas9 technology, resulting in a 73 bp deletion. Absence of peptide expression from this allele was confirmed by immunoblot experiments with brain extracts. (J:306957)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ip6k1 Mutation:  71 strains or lines available
References
Original:  J:306957 Park SJ, et al., Inositol Pyrophosphate Metabolism Regulates Presynaptic Vesicle Cycling at Central Synapses. iScience. 2020 Apr 24;23(4):101000
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory