C5ar1^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: C5ar1^em1(IMPC)H
• Name: complement component 5a receptor 1; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6717139
• Gene: C5ar1 Location: Chr7:15980668-15993465 bp, - strand Genetic Position: Chr7, 8.77 cM
• Alliance: C5ar1^em1(IMPC)H page
• IMPC: C5ar1 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Not Specified
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AGCCCTTATCATCTACTCGG, ATATGCCTCCCGGTACACGA, CACCACCGAGTAGATGATAA, and CGTGTACCGGGAGGCATATA that targeted exon(s) ENSMUSE00000365309.6 ENSMUSE00000914543.2. This resulted in deletion(s) of 524 bp (location: Chr7:15982387-15982910; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any C5ar1 Mutation: 28 strains or lines available

References

• Original: J:169366 MouseBook^TM, Information obtained from MouseBook^TM, Medical Research Council Mammalian Genetics Unit, Harwell, UK. Unpublished. 2005-2013
• All: 2 reference(s)