Tra2b^em2H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tra2b^em2H
• Name: transformer 2 beta; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6716331
• Gene: Tra2b Location: Chr16:22063302-22084755 bp, - strand Genetic Position: Chr16, 13.18 cM
• Alliance: Tra2b^em2H page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Not Specified
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CATGCATTTTGAGAGTCCAA, GATCTGTTCAACCCACCCTT, GGTGGGTTGAACAGATCTAT, and GTGGTCTTCTTAATGCCCTT. This resulted in deletion(s) of 59 bp (location: Chr16:22078501-22078559; GRCm39), 61 bp (location: Chr16:22077371-22077431; GRCm39) and insertions of 62 bp (location: chr16:22077370; GRCm39), 63 bp (location: chr16:22078560; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tra2b Mutation: 24 strains or lines available

References

• Original: J:169366 MouseBook^TM, Information obtained from MouseBook^TM, Medical Research Council Mammalian Genetics Unit, Harwell, UK. Unpublished. 2005-2013
• All: 2 reference(s)