About   Help   FAQ
Dsppem2Jpsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Dsppem2Jpsi
Name: dentin sialophosphoprotein; endonuclease-mediated mutation 2, James Simmer
MGI ID: MGI:6715230
Synonyms: Dspp-DPP
Gene: Dspp  Location: Chr5:104318578-104327993 bp, + strand  Genetic Position: Chr5, 50.59 cM
Alliance: Dsppem2Jpsi page
Mutation
origin
Strain of Origin:  (C57BL/6N x SJL)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsA single nucleotide was duplicated in the coding region of exon 5 (c.1380dupT) using an sgRNA (targeting TTCGATGACGAGTCCATGCAAGG) and an ssODN template with CRISPR/Cas9 technology. This insertion creates a premature stop codon TAA and prevents translation of most of the sequence coding for the dentin phosphoprotein (DPP) domain. (J:326944)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dspp Mutation:  66 strains or lines available
References
Original:  J:326944 Liang T, et al., Mouse Dspp frameshift model of human dentinogenesis imperfecta. Sci Rep. 2021 Oct 19;11(1):20653
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory