About   Help   FAQ
Dsppem1Jpsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Dsppem1Jpsi
Name: dentin sialophosphoprotein; endonuclease-mediated mutation 1, James Simmer
MGI ID: MGI:6715228
Synonyms: Dspp-1fs
Gene: Dspp  Location: Chr5:104318578-104327993 bp, + strand  Genetic Position: Chr5, 50.59 cM
Alliance: Dsppem1Jpsi page
Mutation
origin
Strain of Origin:  (C57BL/6N x SJL)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsSequence for a Flag tag (GACTACAAAGACGATGACGACAAG) was inserted into the sequence coding for the DSP-DPP (dentin sialoprotein-dentin phosphoprotein) cleavage site and a single nucleotide was deleted from the coding region in exon 5 (c.1365delG), immediately downstream of the DPP domain coding sequence, using an sgRNA (targeting TTCGATGACGAGTCCATGCAAGG) and an ssODN template with CRISPR/Cas9 technology. Six additional silent nucleotide modifications were added to prevent further Cas9 mediated editing of the donor molecule following incorporation into the genome. The frameshift mutation extends the reading frame with extraneous codons and changes the in serine- and aspartic acid-rich C-terminal translation to small hydrophobic amino acids alanine- and valine-rich sequence. (J:326944)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dspp Mutation:  67 strains or lines available
References
Original:  J:326944 Liang T, et al., Mouse Dspp frameshift model of human dentinogenesis imperfecta. Sci Rep. 2021 Oct 19;11(1):20653
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory