Dsppem1Jpsi
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dsppem1Jpsi |
| Name: |
dentin sialophosphoprotein; endonuclease-mediated mutation 1, James Simmer |
| MGI ID: |
MGI:6715228 |
| Synonyms: |
Dspp-1fs |
| Gene: |
Dspp Location: Chr5:104318578-104327993 bp, + strand Genetic Position: Chr5, 50.59 cM
|
| Alliance: |
Dsppem1Jpsi page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Epitope tag) |
| Mutations: |
|
Insertion, Nucleotide substitutions
|
| |
|
Mutation details: Sequence for a Flag tag (GACTACAAAGACGATGACGACAAG) was inserted into the sequence coding for the DSP-DPP (dentin sialoprotein-dentin phosphoprotein) cleavage site and a single nucleotide was deleted from the coding region in exon 5 (c.1365delG), immediately downstream of the DPP domain coding sequence, using an sgRNA (targeting TTCGATGACGAGTCCATGCAAGG) and an ssODN template with CRISPR/Cas9 technology. Six additional silent nucleotide modifications were added to prevent further Cas9 mediated editing of the donor molecule following incorporation into the genome. The frameshift mutation extends the reading frame with extraneous codons and changes the in serine- and aspartic acid-rich C-terminal translation to small hydrophobic amino acids alanine- and valine-rich sequence.
(J:326944)
|
|
|
|
|
| Original: |
J:326944 Liang T, et al., Mouse Dspp frameshift model of human dentinogenesis imperfecta. Sci Rep. 2021 Oct 19;11(1):20653 |
| All: |
2 reference(s) |
|