Ccr1l1^em1Semp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccr1l1^em1Semp
• Name: C-C motif chemokine receptor 1 like 1; endonuclease-mediated mutation 1, Sergio M Pontejo
• MGI ID: MGI:6714045
• Synonyms: Ccr1l1^-
• Gene: Ccr1l1 Location: Chr9:123777280-123778445 bp, - strand Genetic Position: Chr9, 75.05 cM, cytoband F
• Alliance: Ccr1l1^em1Semp page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Upstream of the locus and exon 1 were targeted with two sgRNAs (targeting GCTTTGCTATTAAACACGTAGGG and GGTATCTATCAATCGTAAGCAGG) using CRISPR/Cas9 technology, resulting in a 445 bp deletion that includes the start codon. (J:304824)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ccr1l1 Mutation: 11 strains or lines available

References

• Original: J:304824 Kline JM, et al., Structural and functional analysis of Ccr1l1, a Rodentia-restricted eosinophil-selective chemokine receptor homologue. J Biol Chem. 2021 Feb 3;:100373
• All: 1 reference(s)