Ncoa7^em1Pelo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncoa7^em1Pelo
• Name: nuclear receptor coactivator 7; endonuclease-mediated mutation 1, Peter L Oliver
• MGI ID: MGI:6714028
• Synonyms: Ncoa7^del, Ncoa7 DEL
• Gene: Ncoa7 Location: Chr10:30521578-30683401 bp, - strand Genetic Position: Chr10, 17.11 cM
• Alliance: Ncoa7^em1Pelo page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The entire coding region was targeted with sgRNAs targeting sequence upstream of the start codon and downstream of the stop codon (GCGCCCGGCGCCCTGACCGT, ACATGAGTTGGCGAGATCCC) using CRISPR/Cas9 technology, resulting in a 157,481 bp deletion. RT-PCR experiments confirmed the lack of transcription from this allele. (J:305611)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ncoa7 Mutation: 196 strains or lines available

References

• Original: J:305611 Castroflorio E, et al., The Ncoa7 locus regulates V-ATPase formation and function, neurodevelopment and behaviour. Cell Mol Life Sci. 2021 Apr;78(7):3503-3524
• All: 1 reference(s)