About   Help   FAQ
Ncoa7em1Pelo
Endonuclease-mediated Allele Detail
Summary
Symbol: Ncoa7em1Pelo
Name: nuclear receptor coactivator 7; endonuclease-mediated mutation 1, Peter L Oliver
MGI ID: MGI:6714028
Synonyms: Ncoa7del, Ncoa7 DEL
Gene: Ncoa7  Location: Chr10:30521578-30683401 bp, - strand  Genetic Position: Chr10, 17.11 cM
Alliance: Ncoa7em1Pelo page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe entire coding region was targeted with sgRNAs targeting sequence upstream of the start codon and downstream of the stop codon (GCGCCCGGCGCCCTGACCGT, ACATGAGTTGGCGAGATCCC) using CRISPR/Cas9 technology, resulting in a 157,481 bp deletion. RT-PCR experiments confirmed the lack of transcription from this allele. (J:305611)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ncoa7 Mutation:  201 strains or lines available
References
Original:  J:305611 Castroflorio E, et al., The Ncoa7 locus regulates V-ATPase formation and function, neurodevelopment and behaviour. Cell Mol Life Sci. 2021 Apr;78(7):3503-3524
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory