About   Help   FAQ
Myh7bem1Eno
Endonuclease-mediated Allele Detail
Summary
Symbol: Myh7bem1Eno
Name: myosin, heavy chain 7B, cardiac muscle, beta; endonuclease-mediated mutation 1, Eric N Olson
MGI ID: MGI:6712699
Synonyms: MYH7b null
Gene: Myh7b  Location: Chr2:155453132-155476227 bp, + strand  Genetic Position: Chr2, 77.26 cM
Alliance: Myh7bem1Eno page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsExon 2 was targeted with an sgRNA (targeting TGATGGATATGAGTGAACTTGG) and an ssODN containing three poly(A) signals flanked by homology arms using CRISPR/Cas9 technology. In the resulting allele transcription is disrupted by the insertion of premature poly(A) signals in exon 2. (J:285433)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Myh7b Mutation:  81 strains or lines available
References
Original:  J:285433 Peter AK, et al., Expression of Normally Repressed Myosin Heavy Chain 7b in the Mammalian Heart Induces Dilated Cardiomyopathy. J Am Heart Assoc. 2019 Aug 6;8(15):e013318
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory