About   Help   FAQ
Scgnem2Ezb
Endonuclease-mediated Allele Detail
Summary
Symbol: Scgnem2Ezb
Name: secretagogin, EF-hand calcium binding protein; endonuclease-mediated mutation 2, Ezra Burstein
MGI ID: MGI:6711491
Synonyms: Secret2
Gene: Scgn  Location: Chr13:24137439-24175197 bp, - strand  Genetic Position: Chr13, 10.01 cM
Alliance: Scgnem2Ezb page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe 3' end of exon 3 was targeted with an sgRNA (targeting AGGCCGCATACTGATGAAAGAGGT which includes the splice donor site) using CRISPR/Cas9 technology, resulting in a 30 bp deletion that includes exonic and intronic sequence and the exon 3 splice donor site. RT-PCR experiments show that owing to the deleted splice site, exon 3 is skipped during mRNA splicing. Immunofluorescence experiments confirm the absence of peptide expression from this allele. (J:285572)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Scgn Mutation:  21 strains or lines available
References
Original:  J:285572 Sifuentes-Dominguez LF, et al., SCGN deficiency results in colitis susceptibility. Elife. 2019 Oct 30;8:e49910
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory