Scgnem2Ezb
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Scgnem2Ezb |
| Name: |
secretagogin, EF-hand calcium binding protein; endonuclease-mediated mutation 2, Ezra Burstein |
| MGI ID: |
MGI:6711491 |
| Synonyms: |
Secret2 |
| Gene: |
Scgn Location: Chr13:24137439-24175197 bp, - strand Genetic Position: Chr13, 10.01 cM
|
| Alliance: |
Scgnem2Ezb page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The 3' end of exon 3 was targeted with an sgRNA (targeting AGGCCGCATACTGATGAAAGAGGT which includes the splice donor site) using CRISPR/Cas9 technology, resulting in a 30 bp deletion that includes exonic and intronic sequence and the exon 3 splice donor site. RT-PCR experiments show that owing to the deleted splice site, exon 3 is skipped during mRNA splicing. Immunofluorescence experiments confirm the absence of peptide expression from this allele.
(J:285572)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Scgn Mutation: |
21 strains or lines available
|
|
| Original: |
J:285572 Sifuentes-Dominguez LF, et al., SCGN deficiency results in colitis susceptibility. Elife. 2019 Oct 30;8:e49910 |
| All: |
1 reference(s) |
|