Flot2^em1Xidw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Flot2^em1Xidw
• Name: flotillin 2; endonuclease-mediated mutation 1, Xiaodong Wang
• MGI ID: MGI:6696115
• Synonyms: Flot2^-
• Gene: Flot2 Location: Chr11:77928757-77951260 bp, + strand Genetic Position: Chr11, 46.74 cM
• Alliance: Flot2^em1Xidw page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• The allele was created using a gRNA (targeting gtagcctgtgaacagttcct) with CRISPR/Cas9 technology. (J:284332)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Flot2 Mutation: 37 strains or lines available

References

• Original: J:284332 Fan W, et al., Flotillin-mediated endocytosis and ALIX-syntenin-1-mediated exocytosis protect the cell membrane from damage caused by necroptosis. Sci Signal. 2019 May 28;12(583)
• All: 1 reference(s)