Vps13b^em1Yosl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vps13b^em1Yosl
• Name: vacuolar protein sorting 13B; endonuclease-mediated mutation 1, Yong-Seok Lee
• MGI ID: MGI:6695987
• Synonyms: Vps13b^2-
• Gene: Vps13b Location: Chr15:35371306-35931375 bp, + strand Genetic Position: Chr15, 14.46 cM, cytoband B3.3
• Alliance: Vps13b^em1Yosl page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with two sgRNAs (targeting ACGCTTAAATTTGAAGATGCTGG and CGAGTTAAAGTTGGACGTTCTGG) using CRISPR/Cas9 technology, resulting in a 156 bp deletion that includes the start codon. Absence of exon 2 expression in the hippocampus was confirmed by RT-PCR. (J:285279)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Vps13b Mutation: 216 strains or lines available

References

• Original: J:285279 Kim MJ, et al., Spatial Learning and Motor Deficits in Vacuolar Protein Sorting-associated Protein 13b (Vps13b) Mutant Mouse. Exp Neurobiol. 2019 Aug 31;28(4):485-494
• All: 1 reference(s)