Ephb2^em1Cya
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ephb2^em1Cya
• Name: Eph receptor B2; endonuclease-mediated mutation 1, Cyagen Biosciences
• MGI ID: MGI:6693455
• Synonyms: Ephb2^em1Cgen, Ephb2^em1cyagen
• Gene: Ephb2 Location: Chr4:136374850-136563299 bp, - strand Genetic Position: Chr4, 69.0 cM, cytoband D-E
• Alliance: Ephb2^em1Cya page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-cas9 mediated recombination using guide RNAs (GCTCAGAACTAGGCTCCACGTGG and GCTGGGTGCCCTATTAGTGTTGG.) created a 4591 bp deletion spanning exons 7 - 9 and resulting in a frameshift mutation. (J:303645, J:327548)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ephb2 Mutation: 69 strains or lines available

References

• Original: J:303645 Sun W, et al., Cutting Edge: EPHB2 Is a Coreceptor for Fungal Recognition and Phosphorylation of Syk in the Dectin-1 Signaling Pathway. J Immunol. 2021 Apr 1;206(7):1419-1423
• All: 2 reference(s)