About   Help   FAQ
Rag1em10Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Rag1em10Lutzy
Name: recombination activating 1; endonuclease-mediated mutation 10, Cathy Lutz
MGI ID: MGI:6681855
Gene: Rag1  Location: Chr2:101468627-101479846 bp, - strand  Genetic Position: Chr2, 53.88 cM
Alliance: Rag1em10Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 genome editing is used to target intronic DNA flanking exon 2 (guide RNAs - AAGTGTCCCCAAATATTGTC ; GCACCTAGCACATTGCCATG). DNA sequencing of the targeted region identified a 3,527-nt deletion (AGTATAAGTGTCCCCAAAT//3527 deletion//GGTCAGGGATCGATAGTTGACAAG) that results in loss of exon 2 from the genome. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rag1 Mutation:  132 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  18 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory