About   Help   FAQ
Mcuem1Muma
Endonuclease-mediated Allele Detail
Summary
Symbol: Mcuem1Muma
Name: mitochondrial calcium uniporter; endonuclease-mediated mutation 1, Muniswamy Madesh
MGI ID: MGI:6515815
Synonyms: MCU-C96A-KI
Gene: Mcu  Location: Chr10:59282806-59452514 bp, - strand  Genetic Position: Chr10, 29.55 cM
Alliance: Mcuem1Muma page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsA mutation that changes codon 96 from cysteine (TGC) to alanine (GCC) (p.C96A) was created with two gRNAS (targeting GAGAGCTGCGCTCGCGACGGTTA and AAGCCTATCTCTGACTCAGTCGG) and an ssODN template using CRISPR/Cas9 technology. The mutation mimics the human p.C97A gain-of-function mutation that results in a hyperactivated channel activity. (J:284475)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mcu Mutation:  27 strains or lines available
References
Original:  J:284475 Tomar D, et al., Blockade of MCU-Mediated Ca(2+) Uptake Perturbs Lipid Metabolism via PP4-Dependent AMPK Dephosphorylation. Cell Rep. 2019 Mar 26;26(13):3709-3725.e7
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory