About   Help   FAQ
Pdzd8em1Kei
Endonuclease-mediated Allele Detail
Summary
Symbol: Pdzd8em1Kei
Name: PDZ domain containing 8; endonuclease-mediated mutation 1, Keiichi I Nakayama
MGI ID: MGI:6515784
Synonyms: Pdzd8-
Gene: Pdzd8  Location: Chr19:59285610-59334212 bp, - strand  Genetic Position: Chr19, 54.65 cM
Alliance: Pdzd8em1Kei page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 1 was targeted with two sgRNAs (targeting GCAGGCCGAGGGTTGCGGCGGGG and GCAGATTCCCAGCACGACCCTGG) and crRNA and tracrRNA using CRISPR/Cas9 technology. Immunohistochemistry confirmed the lack of peptide expression from this allele in brain. (J:296912)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pdzd8 Mutation:  63 strains or lines available
References
Original:  J:296912 Shirane M, et al., Protrudin and PDZD8 contribute to neuronal integrity by promoting lipid extraction required for endosome maturation. Nat Commun. 2020 Sep 11;11(1):4576
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory