Slc26a5^{em1(HBEGF)Zyliu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc26a5^{em1(HBEGF)Zyliu}
• Name: solute carrier family 26, member 5; endonuclease-mediated mutation 1, Zhiyong Liu
• MGI ID: MGI:6515764
• Synonyms: Prestin-DTR, Prestin-P2A-DTR
• Gene: Slc26a5 Location: Chr5:22015653-22070602 bp, - strand Genetic Position: Chr5, 9.97 cM, cytoband A3
• Alliance: Slc26a5^{em1(HBEGF)Zyliu} page

Mutation origin

• Strain of Origin: C57BL/6NCr

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutation: Insertion
• Slc26a5^{em1(HBEGF)Zyliu} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  HBEGF (1839)

  Hbegf

  (MGI:96070)

• Mutation details: Plasmids encoding a guide RNA (CGAGGCATAAAGGCCCTGTA) are designed to insert a viral 2A oligopeptide (P2A) self cleaving peptide, that mediates ribosomal skipping, followed by a human diphtheria toxin receptor (DTR) immediately upstream of the endogenous stop codon. (J:309477)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc26a5 Mutation: 59 strains or lines available

References

• Original: J:309477 Sun S, et al., Dual expression of Atoh1 and Ikzf2 promotes transformation of adult cochlear supporting cells into outer hair cells. Elife. 2021 Sep;:e66547
• All: 1 reference(s)