Vcpip1^em1Zlou
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vcpip1^em1Zlou
• Name: valosin containing protein (p97)/p47 complex interacting protein 1; endonuclease-mediated mutation 1, Zhenkun Lou
• MGI ID: MGI:6515598
• Synonyms: Vcpip1^-
• Gene: Vcpip1 Location: Chr1:9788847-9818607 bp, - strand Genetic Position: Chr1, 2.08 cM, cytoband A2
• Alliance: Vcpip1^em1Zlou page

Mutation origin

• Strain of Origin: C57BL/6NHsd

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: The gene was targeted with a crRNA/tracrRNA duplex (targeting TTCGGTCCCTTCGTTTCGAA) and an ssODN template (CCGGAAAGGATTCTTCGGTCCCTTCGTTTCCTACAACAGCTTAATTAAGGTTTAAACGCCATGACGAAAGGCCCCCCGGAGAAGCCGCCGCCGCCAGAGA) using CRISPR/Cas9 technology, resulting in the creation of premature stop codons in all three reading frames. Peptide expression from this alleles was absent from mouse embryo fibroblasts (MEFs). (J:297179)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Vcpip1 Mutation: 39 strains or lines available

References

• Original: J:297179 Huang J, et al., Tandem Deubiquitination and Acetylation of SPRTN Promotes DNA-Protein Crosslink Repair and Protects against Aging. Mol Cell. 2020 Sep 3;79(5):824-835.e5
• All: 1 reference(s)