About   Help   FAQ
Golga4em1Syu
Endonuclease-mediated Allele Detail
Summary
Symbol: Golga4em1Syu
Name: golgin A4; endonuclease-mediated mutation 1, Shuiqiao Yuan
MGI ID: MGI:6514717
Gene: Golga4  Location: Chr9:118335335-118411587 bp, + strand  Genetic Position: Chr9, 70.23 cM
Alliance: Golga4em1Syu page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology generated a 11,771 bp deletion of exon 4 through exon 11 using two sgRNAs, sgRNA-1: TTGGTCCGGACGTCCTCCAG and sgRNA-2: TGGTAATAACCGAGACGAAG. Western blot analysis confirmed absence of protein in adult testes. (J:303296)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Golga4 Mutation:  105 strains or lines available
References
Original:  J:303296 Guo S, et al., GOLGA4, A Golgi matrix protein, is dispensable for spermatogenesis and male fertility in mice. Biochem Biophys Res Commun. 2020 Aug 27;529(3):642-646
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory