About   Help   FAQ
Dhddsem1Sjpi
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhddsem1Sjpi
Name: dehydrodolichyl diphosphate synthase; endonuclease-mediated mutation 1, Steven J Pittler
MGI ID: MGI:6513989
Synonyms: DhddsK42E
Gene: Dhdds  Location: Chr4:133696339-133728229 bp, - strand  Genetic Position: Chr4, 66.47 cM
Alliance: Dhddsem1Sjpi page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsA single A-to-G mutation was introduced to change codon 42 from lysine (AAG) to glutamic acid (GAG) (p.K42E), using a gRNA (targeting TCGCTATGCCAAGAAGTGTCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics one associated with an autosomal recessive form of retinitis pigmentosa (RP59) in humans. (J:303192)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dhdds Mutation:  24 strains or lines available
References
Original:  J:303192 Ramachandra Rao S, et al., Lack of Overt Retinal Degeneration in a K42E Dhdds Knock-In Mouse Model of RP59. Cells. 2020 Apr 7;9(4):896
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory