About   Help   FAQ
Zmat3em1Ast
Endonuclease-mediated Allele Detail
Summary
Symbol: Zmat3em1Ast
Name: zinc finger matrin type 3; endonuclease-mediated mutation 1, Andreas Strasser
MGI ID: MGI:6512875
Synonyms: Zmat3-
Gene: Zmat3  Location: Chr3:32388941-32419814 bp, - strand  Genetic Position: Chr3, 15.67 cM, cytoband B
Alliance: Zmat3em1Ast page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThe genomic region containing exons 2-5 was targeted with two sgRNAs (targeting GTCAAGCATACTCCATACCC and GCGGTGTGAATTGCTGTGCC) using CRISPR/Cas9 technology, resulting in a 19773 bp deletion (deleting exons 2-5) and 2 bp insertion (CG). Western blots confirmed the absence of peptide expression from this allele. (J:271583)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Tumor Data
List all tumor models in MMHCdb carrying Zmat3em1Ast
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Zmat3 Mutation:  54 strains or lines available
References
Original:  J:271583 Janic A, et al., DNA repair processes are critical mediators of p53-dependent tumor suppression. Nat Med. 2018 Jul;24(7):947-953
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory