Tmem106b^em2Damme
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem106b^em2Damme
• Name: transmembrane protein 106B; endonuclease-mediated mutation 2, Markus Damme
• MGI ID: MGI:6512075
• Gene: Tmem106b Location: Chr6:13069758-13089268 bp, + strand Genetic Position: Chr6, 5.38 cM, cytoband A2
• Alliance: Tmem106b^em2Damme page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Exon 3 (containing the start codon) was targeted with a gRNA (targeting AGTGAAGTGCACAACGAAGACGG) using CRISPR/Cas9 technology, resulting in a 1 bp insertion (G). (J:288278)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem106b Mutation: 29 strains or lines available

References

• Original: J:288278 Luningschror P, et al., The FTLD Risk Factor TMEM106B Regulates the Transport of Lysosomes at the Axon Initial Segment of Motoneurons. Cell Rep. 2020 Mar 10;30(10):3506-3519.e6
• All: 1 reference(s)