About   Help   FAQ
Tmem106bem1Damme
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem106bem1Damme
Name: transmembrane protein 106B; endonuclease-mediated mutation 1, Markus Damme
MGI ID: MGI:6512073
Synonyms: Tmem106bdel2bp
Gene: Tmem106b  Location: Chr6:13069758-13089268 bp, + strand  Genetic Position: Chr6, 5.38 cM, cytoband A2
Alliance: Tmem106bem1Damme page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 3 (containing the start codon) was targeted with a gRNA (targeting AGTGAAGTGCACAACGAAGACGG) using CRISPR/Cas9 technology, resulting in a 2 bp deletion (AA). Immunoblots of brain and spinal cord lysates confirm the absence of peptide expression from this allele. (J:288278)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tmem106b Mutation:  29 strains or lines available
References
Original:  J:288278 Luningschror P, et al., The FTLD Risk Factor TMEM106B Regulates the Transport of Lysosomes at the Axon Initial Segment of Motoneurons. Cell Rep. 2020 Mar 10;30(10):3506-3519.e6
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory