About   Help   FAQ
Spi1em1Aduci
Endonuclease-mediated Allele Detail
Summary
Symbol: Spi1em1Aduci
Name: Spi-1 proto-oncogene; endonuclease-mediated mutation 1, Frank LaFerla
MGI ID: MGI:6512052
Gene: Spi1  Location: Chr2:90912750-90946104 bp, + strand  Genetic Position: Chr2, 50.44 cM, cytoband E3
Alliance: Spi1em1Aduci page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGuide RNAs (GCTATGCTTAAGTCAGGCTT and ATTGTGGCTATGCTTAAGTC) are designed to create a C to T missense mutation resulting in a mutation orthologous to the location of human SNP rs1377416. Human SNP rs1377416 has been found in human SPI1 and is a functional variant that is active in human myeloid cells and in the brain of a mouse model of Alzheimer's disease (AD). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Spi1 Mutation:  30 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory