Spi1^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spi1^em1Aduci
• Name: Spi-1 proto-oncogene; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:6512052
• Gene: Spi1 Location: Chr2:90912750-90946104 bp, + strand Genetic Position: Chr2, 50.44 cM, cytoband E3
• Alliance: Spi1^em1Aduci page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Guide RNAs (GCTATGCTTAAGTCAGGCTT and ATTGTGGCTATGCTTAAGTC) are designed to create a C to T missense mutation resulting in a mutation orthologous to the location of human SNP rs1377416. Human SNP rs1377416 has been found in human SPI1 and is a functional variant that is active in human myeloid cells and in the brain of a mouse model of Alzheimer's disease (AD). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Spi1 Mutation: 27 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)