About   Help   FAQ
Ttnem1Kage
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttnem1Kage
Name: titin; endonuclease-mediated mutation 1, Katja Gehmlich
MGI ID: MGI:6511815
Synonyms: A178D
Gene: Ttn  Location: Chr2:76534324-76812891 bp, - strand  Genetic Position: Chr2, 45.13 cM, cytoband D
Alliance: Ttnem1Kage page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsUsing CRISPR/Cas9 technology with an sgRNA (targeting AGCTCTTCCAACGCTGTTGG) and an ssODN template, a C-to-A mutation (c.533C>A) that changes alanine codon 178 to an aspartic acid codon (p.A178D) was created. This mutation mimics a mutation found in a family of autosomal dominant left ventricular non-compaction (LVNC) and familial dilated cardiomyopathy (DCM) patients. Transcript and peptide expression was not affected by this mutation, nor was localisation of the peptide. (J:302920)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ttn Mutation:  1456 strains or lines available
References
Original:  J:302920 Jiang H, et al., Functional analysis of a gene-edited mouse model to gain insights into the disease mechanisms of a titin missense variant. Basic Res Cardiol. 2021 Feb 26;116(1):14
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory