About   Help   FAQ
Usp28em1Baz
Endonuclease-mediated Allele Detail
Summary
Symbol: Usp28em1Baz
Name: ubiquitin specific peptidase 28; endonuclease-mediated mutation 1, Hisham Bazzi
MGI ID: MGI:6510239
Gene: Usp28  Location: Chr9:48896675-48953817 bp, + strand  Genetic Position: Chr9, 26.56 cM
Alliance: Usp28em1Baz page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsCRISPR/Cas9 technology generated a 1 bp insertion in exon 2 (AATCAGCTGCGAGAAATCAC to AATCAGCTGCGAGAAATTCAC) using the gRNA AATCAGCTGCGAGAAATCAC. (J:302304)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Usp28 Mutation:  79 strains or lines available
References
Original:  J:302304 Xiao C, et al., Gradual centriole maturation associates with the mitotic surveillance pathway in mouse development. EMBO Rep. 2021 Feb 3;22(2):e51127
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory