About   Help   FAQ
Cdc40em1Jgg
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdc40em1Jgg
Name: cell division cycle 40; endonuclease-mediated mutation 1, Joseph Gleeson
MGI ID: MGI:6509468
Synonyms: Prp17p.P95A
Gene: Cdc40  Location: Chr10:40707617-40759139 bp, - strand  Genetic Position: Chr10, 22.06 cM, cytoband B1
Alliance: Cdc40em1Jgg page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsUsing a crRNA (targeting TTCCTTATATCGTTGCAGTT), tracrRNA and an ssODN template (GGATTAGAGTTGAAAATACATTGTAATTTCAGGATCCTTCTTTTCCTTCCTTATATCGTTGCAGTTTGGAGCAGAAAATCCCTTTCGAACACAGCAAATGGCTGCCCCTAGAAATATGCTTTCTGGGTATGCAGAGCCAGC) with CRISPR/Cas9 technology, a C-to-G mutation (G-to-C on forward strand) was engineered to change proline codon 95 (CCA) to an alanine codon (GCA) (p.P95A). This mutation creates a non-isomerizable form of the encoded peptide. (J:300487)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cdc40 Mutation:  35 strains or lines available
References
Original:  J:300487 Chai G, et al., Mutations in Spliceosomal Genes PPIL1 and PRP17 Cause Neurodegenerative Pontocerebellar Hypoplasia with Microcephaly. Neuron. 2021 Jan 20;109(2):241-256.e9
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory