Ppil1em5Jgg
Endonuclease-mediated Allele Detail
|
Symbol: |
Ppil1em5Jgg |
Name: |
peptidylprolyl isomerase (cyclophilin)-like 1; endonuclease-mediated mutation 5, Joseph Gleeson |
MGI ID: |
MGI:6509463 |
Synonyms: |
Ppil1R55A |
Gene: |
Ppil1 Location: Chr17:29469809-29482945 bp, - strand Genetic Position: Chr17, 15.15 cM
|
Alliance: |
Ppil1em5Jgg page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Using a crRNA (targeting TGAAGTCCTTGATGATCCTG), tracrRNA and an ssODN template (GTCATTGTCCTGGAGCTATACTGGAAGCATGCGCCCAAGACCTGCAAGAACTTCGCGGAGCTGGCTCGGCGGGGCTACTACAATGGCACCAAGTTTCACCGGATCATCAAGGACTTCATGATCCAAGGCGGCGACCCGACAGGCACAGGTACACTTAAGCCACCATTGGGGAGGAACTGGGTGGTAAGGCAGCCACAGCT) with CRISPR/Cas9 technology, an AG-to-GC mutation (CT-to-GC on forward strand) was engineered to change arginine codon 55 (AGG) to an alanine codon (GCG) (p.R55A). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients.
(J:300487)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Ppil1 Mutation: |
38 strains or lines available
|
|
Original: |
J:300487 Chai G, et al., Mutations in Spliceosomal Genes PPIL1 and PRP17 Cause Neurodegenerative Pontocerebellar Hypoplasia with Microcephaly. Neuron. 2021 Jan 20;109(2):241-256.e9 |
All: |
1 reference(s) |
|