About   Help   FAQ
Ppil1em5Jgg
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppil1em5Jgg
Name: peptidylprolyl isomerase (cyclophilin)-like 1; endonuclease-mediated mutation 5, Joseph Gleeson
MGI ID: MGI:6509463
Synonyms: Ppil1R55A
Gene: Ppil1  Location: Chr17:29469809-29482945 bp, - strand  Genetic Position: Chr17, 15.15 cM
Alliance: Ppil1em5Jgg page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing a crRNA (targeting TGAAGTCCTTGATGATCCTG), tracrRNA and an ssODN template (GTCATTGTCCTGGAGCTATACTGGAAGCATGCGCCCAAGACCTGCAAGAACTTCGCGGAGCTGGCTCGGCGGGGCTACTACAATGGCACCAAGTTTCACCGGATCATCAAGGACTTCATGATCCAAGGCGGCGACCCGACAGGCACAGGTACACTTAAGCCACCATTGGGGAGGAACTGGGTGGTAAGGCAGCCACAGCT) with CRISPR/Cas9 technology, an AG-to-GC mutation (CT-to-GC on forward strand) was engineered to change arginine codon 55 (AGG) to an alanine codon (GCG) (p.R55A). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients. (J:300487)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ppil1 Mutation:  38 strains or lines available
References
Original:  J:300487 Chai G, et al., Mutations in Spliceosomal Genes PPIL1 and PRP17 Cause Neurodegenerative Pontocerebellar Hypoplasia with Microcephaly. Neuron. 2021 Jan 20;109(2):241-256.e9
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory