Ppil1em4Jgg
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ppil1em4Jgg |
| Name: |
peptidylprolyl isomerase (cyclophilin)-like 1; endonuclease-mediated mutation 4, Joseph Gleeson |
| MGI ID: |
MGI:6509462 |
| Synonyms: |
Ppil1R131Q |
| Gene: |
Ppil1 Location: Chr17:29469809-29482945 bp, - strand Genetic Position: Chr17, 15.15 cM
|
| Alliance: |
Ppil1em4Jgg page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Using a crRNA (targeting TCCCTATACCCTGGCACACT), a tracrRNA and an ssODN template (GGTCCTGGGAGTTTGTTTCCACCATGCCCACTCGATTCACCATCCCTATACCCTGGCACACTTGTCCAAAAATAGTATGCTTGCCGTCCAGCCATTGCGTGGGGGCCAGGGTCACAAAGAAC) with CRISPR/Cas9 technology, a single G-to-A mutation (C-to-T on forward strand) was engineered to change arginine codon 131 (CGA) to a glutamine codon (CAA) (p.R131Q). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients.
(J:300487)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ppil1 Mutation: |
38 strains or lines available
|
|
| Original: |
J:300487 Chai G, et al., Mutations in Spliceosomal Genes PPIL1 and PRP17 Cause Neurodegenerative Pontocerebellar Hypoplasia with Microcephaly. Neuron. 2021 Jan 20;109(2):241-256.e9 |
| All: |
1 reference(s) |
|