Gt(ROSA)26Sor^{em2(CAG-tdTomato)Jahe}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em2(CAG-tdTomato)Jahe}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 2, Jason Heaney
• MGI ID: MGI:6508540
• Synonyms: Ai9-Cas12a
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em2(CAG-tdTomato)Jahe} page

Mutation origin

• Strain of Origin: B6.Cg-Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}/J
• Project Collection: CPMM

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 editing of Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze} (Ai9) was modified to duplicate a guide target sequences for A.s. and L.b. Cas12a found on the 5' end of the loxP-flanked stop cassette [5'(PAM TTTG) GCAAAGAATTGATTTGATACCGC] onto the 3' end of the stop cassette. With this modification, a single guide RNA for A.s. or L.b. Cas12a can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. CRISPR-modification of Ai9 lead to the partial deletion of the loxP site on the 3' end of the stop cassette. It is believed that the remaining sequence is not sufficient for Cre-mediated recombination with the 5' loxP site. (J:302569)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 942 strains or lines available

Notes

This allele was generated from Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}.

References

• Original: J:302569 Heaney J, Direct data submission for Gt(ROSA)26Sor allele from Dr. Heaney. MGI Direct Data Submission. 2021
• All: 1 reference(s)