About   Help   FAQ
Vps35lem1Shis
Endonuclease-mediated Allele Detail
Summary
Symbol: Vps35lem1Shis
Name: VPS35 endosomal protein sorting factor like; endonuclease-mediated mutation 1, Shinji Saitoh
MGI ID: MGI:6507962
Synonyms: Vps35l-
Gene: Vps35l  Location: Chr7:118339401-118440712 bp, + strand  Genetic Position: Chr7, 63.61 cM, cytoband F3
Alliance: Vps35lem1Shis page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 10 was targeted with an sgRNA (targeting CCATCCGGGAACTCATTCCAAGA) using CRISPR/Cas9 technology, resulting in a 2 bp deletion of CG. Exon 10 contains mutations in human patients presenting with a phenotype similar to, but distinct from, cranio-cerebello-cardiac/Ritscher-Schinzel syndrome (3C/RSS). (J:301722)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Vps35l Mutation:  59 strains or lines available
References
Original:  J:301722 Kato K, et al., Biallelic VPS35L pathogenic variants cause 3C/Ritscher-Schinzel-like syndrome through dysfunction of retriever complex. J Med Genet. 2020 Apr;57(4):245-253
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory