Dhx15^em1Flv
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhx15^em1Flv
• Name: DEAH-box helicase 15; endonuclease-mediated mutation 1, Richard A Flavell
• MGI ID: MGI:6507764
• Synonyms: Dhx15^f
• Gene: Dhx15 Location: Chr5:52307545-52347856 bp, - strand Genetic Position: Chr5, 27.51 cM, cytoband C1
• Alliance: Dhx15^em1Flv page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: LoxP sites were inserted upstream of exon 1 and into intron 3 using two gRNAs (targeting TGAACTGCAGCAGCGTTCCT and AGATATTATTAGAGTAGCCG) and two ssODN templates with CRISPR/Cas9 technology, creating a conditional-ready allele with exons 1-3 floxed. (J:302140)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dhx15 Mutation: 41 strains or lines available

References

• Original: J:302140 Wang Y, et al., The RNA helicase Dhx15 mediates Wnt-induced antimicrobial protein expression in Paneth cells. Proc Natl Acad Sci U S A. 2021 Jan 26;118(4):e2017432118
• All: 1 reference(s)