About   Help   FAQ
Dhx15em1Flv
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhx15em1Flv
Name: DEAH-box helicase 15; endonuclease-mediated mutation 1, Richard A Flavell
MGI ID: MGI:6507764
Synonyms: Dhx15f
Gene: Dhx15  Location: Chr5:52307545-52347856 bp, - strand  Genetic Position: Chr5, 27.51 cM, cytoband C1
Alliance: Dhx15em1Flv page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsLoxP sites were inserted upstream of exon 1 and into intron 3 using two gRNAs (targeting TGAACTGCAGCAGCGTTCCT and AGATATTATTAGAGTAGCCG) and two ssODN templates with CRISPR/Cas9 technology, creating a conditional-ready allele with exons 1-3 floxed. (J:302140)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dhx15 Mutation:  41 strains or lines available
References
Original:  J:302140 Wang Y, et al., The RNA helicase Dhx15 mediates Wnt-induced antimicrobial protein expression in Paneth cells. Proc Natl Acad Sci U S A. 2021 Jan 26;118(4):e2017432118
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory