About   Help   FAQ
Gt(ROSA)26Sorem1(CAG-tdTomato)Jahe
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem1(CAG-tdTomato)Jahe
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Jason Heaney
MGI ID: MGI:6507752
Synonyms: Ai9-SauSpyCas9
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem1(CAG-tdTomato)Jahe page
Mutation
origin
Strain of Origin:  B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J
Project Collection: CPMM
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Reporter)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTATT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. (J:302103)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1042 strains or lines available
Notes
This allele was generated from Gt(ROSA)26Sortm9(CAG-tdTomato)Hze.
References
Original:  J:302103 Heaney J, Direct data submission of a CRISPR-modified Ai9 allele. MGI Direct Data Submission. 2020;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory