About   Help   FAQ
Abca7em1Aduci
Endonuclease-mediated Allele Detail
Summary
Symbol: Abca7em1Aduci
Name: ATP-binding cassette, sub-family A member 7; endonuclease-mediated mutation 1, Frank LaFerla
MGI ID: MGI:6506295
Synonyms: Abca7V1613M
Gene: Abca7  Location: Chr10:79832328-79851406 bp, + strand  Genetic Position: Chr10, 39.72 cM
Alliance: Abca7em1Aduci page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGuide RNA (CTTGGTGGCAGTGTGCATAG) is designed to create a guanine to adenine missense mutation resulting in a valine to methionine change (V1613M) in the gene. This mutation (SNP rs117187003) is homologous to the human V1599M SNP which has been associated with increased risk of sporadic Alzheimer's disease. Two silent DNA mutations were also introduced just upstream of the mutation. (J:350686)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Abca7 Mutation:  88 strains or lines available
References
Original:  J:350686 Butler CA, et al., The Abca7(V1613M) variant reduces Abeta generation, plaque load, and neuronal damage. Alzheimers Dement. 2024 Jul;20(7):4914-4934
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory