Abca7^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abca7^em1Aduci
• Name: ATP-binding cassette, sub-family A member 7; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:6506295
• Synonyms: Abca7^V1613M
• Gene: Abca7 Location: Chr10:79832328-79851406 bp, + strand Genetic Position: Chr10, 39.72 cM
• Alliance: Abca7^em1Aduci page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Guide RNA (CTTGGTGGCAGTGTGCATAG) is designed to create a guanine to adenine missense mutation resulting in a valine to methionine change (V1613M) in the gene. This mutation (SNP rs117187003) is homologous to the human V1599M SNP which has been associated with increased risk of sporadic Alzheimer's disease. Two silent DNA mutations were also introduced just upstream of the mutation. (J:350686)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Abca7 Mutation: 88 strains or lines available

References

• Original: J:350686 Butler CA, et al., The Abca7(V1613M) variant reduces Abeta generation, plaque load, and neuronal damage. Alzheimers Dement. 2024 Jul;20(7):4914-4934
• All: 1 reference(s)