About   Help   FAQ
Rnf183em1Kaim
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf183em1Kaim
Name: ring finger protein 183; endonuclease-mediated mutation 1, Kazunori Imaizumi
MGI ID: MGI:6488086
Synonyms: RNF183-GFP
Gene: Rnf183  Location: Chr4:62345777-62353487 bp, - strand  Genetic Position: Chr4, 33.13 cM
Alliance: Rnf183em1Kaim page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsThe GFP fluorescent marker gene and linker sequence was inserted upstream of the coding region in exon 3 using a donor plasmid, a crRNA (CAGAGGAUGAGCGAACCACAGUUUUAGAGCUAUGCUGUUUUG) and a tracrRNA (AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU) with CRISPR/Cas9 technology. (J:291079)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rnf183 Mutation:  13 strains or lines available
References
Original:  J:291079 Maeoka Y, et al., Renal medullary tonicity regulates RNF183 expression in the collecting ducts via NFAT5. Biochem Biophys Res Commun. 2019 Jun 25;514(2):436-442
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory