Brme1^em1Keish
Endonuclease-mediated Allele Detail

Summary

• Symbol: Brme1^em1Keish
• Name: break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 1, Kei-ichiro Ishiguro
• MGI ID: MGI:6478915
• Synonyms: 4930432K21Rik Ex3-9delta, Brme1 KO
• Gene: Brme1 Location: Chr8:84874654-84899219 bp, + strand Genetic Position: Chr8, 40.35 cM, cytoband C3
• Alliance: Brme1^em1Keish page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 3-9 were targeted for deletion with two synthetic crRNAs (targeting GCAGGAAGTTCATAGCCACA(ggg) and TGGGTAACAGATCTACACAC(agg)) and an ssODN (GGCTACAACTACAGGGAGGTTTTGTGCTCTCTAACCTGTGaattcGGCTATGAACTTCCTGCCGC CATCAGCTTCCAAAATACAG) using CRISPR/Cas9 technology. (J:291970)

Expression

In Mice Carrying this Mutation:

10 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Brme1 Mutation: 24 strains or lines available

References

• Original: J:291970 Takemoto K, et al., Meiosis-Specific C19orf57/4930432K21Rik/BRME1 Modulates Localization of RAD51 and DMC1 to DSBs in Mouse Meiotic Recombination. Cell Rep. 2020 May 26;31(8):107686
• All: 1 reference(s)