About   Help   FAQ
Brme1em1Keish
Endonuclease-mediated Allele Detail
Summary
Symbol: Brme1em1Keish
Name: break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 1, Kei-ichiro Ishiguro
MGI ID: MGI:6478915
Synonyms: 4930432K21Rik Ex3-9delta, Brme1 KO
Gene: Brme1  Location: Chr8:84874654-84899219 bp, + strand  Genetic Position: Chr8, 40.35 cM, cytoband C3
Alliance: Brme1em1Keish page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExons 3-9 were targeted for deletion with two synthetic crRNAs (targeting GCAGGAAGTTCATAGCCACA(ggg) and TGGGTAACAGATCTACACAC(agg)) and an ssODN (GGCTACAACTACAGGGAGGTTTTGTGCTCTCTAACCTGTGaattcGGCTATGAACTTCCTGCCGC CATCAGCTTCCAAAATACAG) using CRISPR/Cas9 technology. (J:291970)
Expression
In Mice Carrying this Mutation: 10 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Brme1 Mutation:  24 strains or lines available
References
Original:  J:291970 Takemoto K, et al., Meiosis-Specific C19orf57/4930432K21Rik/BRME1 Modulates Localization of RAD51 and DMC1 to DSBs in Mouse Meiotic Recombination. Cell Rep. 2020 May 26;31(8):107686
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory