About   Help   FAQ
Lrrc34em1Doson
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrrc34em1Doson
Name: leucine rich repeat containing 34; endonuclease-mediated mutation 1, DongSong Nie
MGI ID: MGI:6476971
Synonyms: Spata34-
Gene: Lrrc34  Location: Chr3:30678416-30701967 bp, - strand  Genetic Position: Chr3, 14.27 cM, cytoband A3
Alliance: Lrrc34em1Doson page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExons 3 and 4 were targeted with sgRNAs (GATCACTAATACGACTCACTATAGGCTCCGGACAAAGAATAACGTTTTAGCTAGAAAT and GATCACTAATACGACTCACTATAGGCATCGGCGATGTCGGTGCGTTTTAGAGCTAGAAAT) using CRISPR/Cas9 technology, resulting in a 274 bp deletion (including a 122 bp deletion of the entire exon 3 and a 35 bp deletion of the 5' end of exon 4). RT-PCR experiments confirm lack of expression from this allele. (J:293535)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lrrc34 Mutation:  45 strains or lines available
References
Original:  J:293535 Nie D, et al., The testis-specific expressed gene Spata34 is not required for fertility in mice. Mol Biol Rep. 2020 Jan;47(1):285-292
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory