Tsn^em1Jbar
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tsn^em1Jbar
• Name: translin; endonuclease-mediated mutation 1, Jay M Baraban
• MGI ID: MGI:6476693
• Synonyms: Tsn^fl
• Gene: Tsn Location: Chr1:118226244-118239463 bp, - strand Genetic Position: Chr1, 52.14 cM
• Alliance: Tsn^em1Jbar page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Guide RNAs (TTATCCGTCCTATTGCTAGA and ATAGGGGTTTGGTCATTTTG) are designed to insert loxP sites flanking exon 2 of the gene. A silent protospacer adjacent motif (PAM) is also introduced to prevent gRNA editing of the donor template. (J:297214)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tsn Mutation: 28 strains or lines available

References

• Original: J:297214 Fu X, et al., Genetic inactivation of the translin/trax microRNA-degrading enzyme phenocopies the robust adiposity induced by Translin (Tsn) deletion. Mol Metab. 2020 Oct;40:101013
• All: 3 reference(s)