Tsnax^em1Jbar
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tsnax^em1Jbar
• Name: translin-associated factor X; endonuclease-mediated mutation 1, Jay M Baraban
• MGI ID: MGI:6476691
• Synonyms: TX(E126A)
• Gene: Tsnax Location: Chr8:125739780-125760947 bp, + strand Genetic Position: Chr8, 73.1 cM
• Alliance: Tsnax^em1Jbar page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: A guide RNA (TTTAGGACTGCAGGAATACG) is designed to insert point mutations (GAA to GCC) resulting in a glutamic acid to alanine change at amino acid 126 (E126A) in exon 5. This mutation abolishes the RNase activity of the enzyme encoded by this gene. This guide RNA introduced a StuI restriction site to facilitate genotyping and inactivated a protospacer adjacent motif (PAM)to prevent gRNA editing of the donor template. (J:297214)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tsnax Mutation: 18 strains or lines available

References

• Original: J:297214 Fu X, et al., Genetic inactivation of the translin/trax microRNA-degrading enzyme phenocopies the robust adiposity induced by Translin (Tsn) deletion. Mol Metab. 2020 Oct;40:101013
• All: 1 reference(s)