About   Help   FAQ
Notch1em1Rko
Endonuclease-mediated Allele Detail
Summary
Symbol: Notch1em1Rko
Name: notch 1; endonuclease-mediated mutation 1, Raphael Kopan
MGI ID: MGI:6472980
Synonyms: N1R1974A, N1RA
Gene: Notch1  Location: Chr2:26347914-26393834 bp, - strand  Genetic Position: Chr2, 18.91 cM
Alliance: Notch1em1Rko page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 1974 wast targeted with a gRNA (CATTCGGGCATCCAGATCTG) and a donor oligonucleotide using CRISPR/Cas9 technology. The resulting arginine to alanine mutation (p.R1974A) prevents dimerization of proteolytically created Notch intracellular domains (NICDs). (J:296947)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Notch1 Mutation:  116 strains or lines available
References
Original:  J:296947 Kobia FM, et al., Notch dimerization and gene dosage are important for normal heart development, intestinal stem cell maintenance, and splenic marginal zone B-cell homeostasis during mite infestation. PLoS Biol. 2020 Oct;18(10):e3000850
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory