Notch1^em1Rko
Endonuclease-mediated Allele Detail

Summary

• Symbol: Notch1^em1Rko
• Name: notch 1; endonuclease-mediated mutation 1, Raphael Kopan
• MGI ID: MGI:6472980
• Synonyms: N1^R1974A, N1^RA
• Gene: Notch1 Location: Chr2:26347914-26393834 bp, - strand Genetic Position: Chr2, 18.91 cM
• Alliance: Notch1^em1Rko page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 1974 wast targeted with a gRNA (CATTCGGGCATCCAGATCTG) and a donor oligonucleotide using CRISPR/Cas9 technology. The resulting arginine to alanine mutation (p.R1974A) prevents dimerization of proteolytically created Notch intracellular domains (NICDs). (J:296947)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Notch1 Mutation: 116 strains or lines available

References

• Original: J:296947 Kobia FM, et al., Notch dimerization and gene dosage are important for normal heart development, intestinal stem cell maintenance, and splenic marginal zone B-cell homeostasis during mite infestation. PLoS Biol. 2020 Oct;18(10):e3000850
• All: 2 reference(s)