About   Help   FAQ
Tns2em2Nsas
Endonuclease-mediated Allele Detail
Summary
Symbol: Tns2em2Nsas
Name: tensin 2; endonuclease-mediated mutation 2, Nobuya Sasaki
MGI ID: MGI:6471943
Synonyms: Tns2C231S, Tns2CS
Gene: Tns2  Location: Chr15:102008848-102024836 bp, + strand  Genetic Position: Chr15, 57.29 cM
Alliance: Tns2em2Nsas page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsCysteine codon 231 (TGC) in exon 9 was changed to serine (AGC) (p.C231S) using an sgRNA (targeting CGTGGTTGTGTTGTACTGCA ) and an ssODN template with CRISPR/Cas9 technology. (J:296747)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tns2 Mutation:  116 strains or lines available
References
Original:  J:296747 Sasaki H, et al., Deletion of the Tensin2 SH2-PTB domain, but not the loss of its PTPase activity, induces podocyte injury in FVB/N mouse strain. Exp Anim (Tokyo). 2020;69(2):135-143
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory